BGI 5128 PDF

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Malazilkree Moogucage
Country: Brunei Darussalam
Language: English (Spanish)
Genre: Sex
Published (Last): 12 May 2004
Pages: 449
PDF File Size: 11.17 Mb
ePub File Size: 17.63 Mb
ISBN: 361-1-43662-479-7
Downloads: 75935
Price: Free* [*Free Regsitration Required]
Uploader: Goltigis

Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding.

Preços referenciais B3 – prêmios de opções

Oxford University Press is a department of 5218 University of Oxford. The enzymes from the fungus Neurospora crassa and the yeast Williopsis saturnus var.

Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate. A total of C ]; O2 [CPD: Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli. Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate. In order to improve the aquaculture yield of this valuable fish species, we are trying to develop genomic resources for assistant selection in genetic breeding.

  DARTHS AND DROIDS PDF

The contig N50 and scaffold N50 reached Oxidoreductases; Acting on paired donors, with incorporation or reduction of molecular oxygen; With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donor.

Re analyzing community-wide datasets without major infrastructure. It gbi become very popular in China for its wide use in traditional Chinese medicine. Gadda G, Francis K. J Biol Chem The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds.

bi Characterization of 4-hydroxyphenylacetate 3-hydroxylase HpaB of Escherichia coli as a reduced flavin adenine dinucleotide-utilizing monooxygenase. Bgu Biol Chem Citing articles via Web of Science 2. Characterization of the anthranilate degradation pathway in Geobacillus thermodenitrificans NG GigaScienceVolume 6, Issue 6, 1 Junegix, https: Francis K, Gadda G. Email alerts New issue alert.

Appl Environ Microbiol C ]; other products. Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase. R R R R R Neither hydrogen peroxide nor superoxide were detected during enzyme turnover.

  B564A DATASHEET PDF

Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: Oxidoreductases; Acting on single donors with incorporation of molecular oxygen oxygenases ; With incorporation of one atom of oxygen internal monooxygenases or internal 51128 oxidases. Xun L, Sandvik ER.

Draft genome of the lined seahorse, Hippocampus erectus | GigaScience | Oxford Academic

ExplorEnz – The Enzyme Database: In progress issue bgo. The lined seahorse, Hippocampus erectusis an Atlantic species and mainly inhabits shallow sea beds or coral reefs.

Close mobile search navigation Article navigation. The enzyme uses FADH2 as a substrate rather than a cofactor [4]. ExplorEnz – The Enzyme Database: The enzyme from N.

The Glasgow Herald – Google News Archive Search

Availability of supporting data. C ]; O2 [CPD: Related articles in Web of Science Google Scholar. Kinetic evidence for an anion binding pocket in the active site of nitronate monooxygenase.